Product Details
- SNP ID
-
hCV191740154
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.7:149874162 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCCCTGGTTCGTGCCGAAGGGACCC[G/A]ACCGCGGGTAAGGAAAGCGCGCAGG
- Phenotype
-
MIM: 611019
- Polymorphism
- G/A, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
ACTR3C
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs12112087] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ACTR3C
- Gene Name
- ARP3 actin-related protein 3 homolog C
There are no transcripts associated with this gene.
- Gene
- ATP6V0E2
- Gene Name
- ATPase H+ transporting V0 subunit e2
There are no transcripts associated with this gene.
- Gene
- ATP6V0E2-AS1
- Gene Name
- ATP6V0E2 antisense RNA 1
There are no transcripts associated with this gene.
- Gene
- ZNF862
- Gene Name
- zinc finger protein 862
There are no transcripts associated with this gene.
View Full Product Details