Product Details

SNP ID
rs200332502
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.8:67064458 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CTTCGGTCCGCGACGATCCTCTAGA[A/G]CACTGTGTGTCTCCCCGGACGCGAG
Phenotype
MIM: 604850 MIM: 611654
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
COPS5 PubMed Links

Gene Details

Gene
COPS5
Gene Name
COP9 signalosome subunit 5
There are no transcripts associated with this gene.

Gene
CSPP1
Gene Name
centrosome and spindle pole associated protein 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001291339.1 93 Intron NP_001278268.1
NM_024790.6 93 Silent Mutation GAA,GAG E20E NP_079066.5
XM_005251305.3 93 Silent Mutation GAA,GAG E66E XP_005251362.2
XM_006716474.2 93 Silent Mutation GAA,GAG E66E XP_006716537.2
XM_006716477.2 93 Silent Mutation GAA,GAG E66E XP_006716540.2
XM_011517598.1 93 Silent Mutation GAA,GAG E66E XP_011515900.1
XM_011517599.1 93 Silent Mutation GAA,GAG E66E XP_011515901.1
XM_011517600.1 93 Silent Mutation GAA,GAG E66E XP_011515902.1
XM_011517601.1 93 Silent Mutation GAA,GAG E66E XP_011515903.1
XM_011517602.1 93 Silent Mutation GAA,GAG E66E XP_011515904.1
XM_011517603.1 93 UTR 5 XP_011515905.1
XM_011517607.1 93 Intron XP_011515909.1
XM_011517608.1 93 UTR 5 XP_011515910.1
XM_011517609.1 93 Intron XP_011515911.1
XM_011517611.2 93 Intron XP_011515913.1
XM_017013847.1 93 Silent Mutation GAA,GAG E66E XP_016869336.1
XM_017013848.1 93 Silent Mutation GAA,GAG E66E XP_016869337.1
XM_017013849.1 93 Silent Mutation GAA,GAG E66E XP_016869338.1
XM_017013850.1 93 Silent Mutation GAA,GAG E66E XP_016869339.1
XM_017013851.1 93 UTR 5 XP_016869340.1
XM_017013852.1 93 Silent Mutation GAA,GAG E66E XP_016869341.1
XM_017013853.1 93 UTR 5 XP_016869342.1
XM_017013854.1 93 Silent Mutation GAA,GAG E66E XP_016869343.1
XM_017013855.1 93 Silent Mutation GAA,GAG E66E XP_016869344.1
XM_017013856.1 93 UTR 5 XP_016869345.1
XM_017013857.1 93 Intron XP_016869346.1
XM_017013858.1 93 Intron XP_016869347.1
XM_017013859.1 93 Intron XP_016869348.1

View Full Product Details