Product Details

SNP ID: rs3747751
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.6:41790845 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TGAGTCTACACTGGGTTGACTCTGA[A/G]AGGTTTATATCTTATTGGGTATTAA
Phenotype: MIM: 611389 MIM: 616168
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: PRICKLE4 PubMed Links

Gene Details

Gene: PRICKLE4
Gene Name: prickle planar cell polarity protein 4

There are no transcripts associated with this gene.

Gene: TOMM6
Gene Name: translocase of outer mitochondrial membrane 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134493.1	7857	Intron			NP_001127965.1

Gene: USP49
Gene Name: ubiquitin specific peptidase 49

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286554.1	7857	UTR 3			NP_001273483.1
NM_018561.4	7857	Intron			NP_061031.2

View Full Product Details