Product Details

SNP ID: rs80358232
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:50523738 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGGTTGAGCAGGTAGATGGCAATG[G/A]AGTGGTCCACGATGTAGTCCTGGTC
Phenotype: MIM: 611230 MIM: 604272 MIM: 131222
Polymorphism: G/A, Transition substitution
Allele Nomenclature
Literature Links: NCAPH2 PubMed Links

Gene Details

Gene: NCAPH2
Gene Name: non-SMC condensin II complex subunit H2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001185011.1	821	UTR 3			NP_001171940.1
NM_014551.4	821	Intron			NP_055366.3
NM_152299.3	821	UTR 3			NP_689512.2
XM_005261912.4	821	Intron			XP_005261969.1
XM_011530685.2	821	Intron			XP_011528987.1
XM_017028793.1	821	Intron			XP_016884282.1

Gene: ODF3B
Gene Name: outer dense fiber of sperm tails 3B

There are no transcripts associated with this gene.

Gene: SCO2
Gene Name: SCO2 cytochrome c oxidase assembly protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001169109.1	821	Missense Mutation	TCC,TTC	S225F	NP_001162580.1
NM_001169110.1	821	Missense Mutation	TCC,TTC	S225F	NP_001162581.1
NM_001169111.1	821	Missense Mutation	TCC,TTC	S225F	NP_001162582.1
NM_005138.2	821	Missense Mutation	TCC,TTC	S225F	NP_005129.2

Gene: TYMP
Gene Name: thymidine phosphorylase

There are no transcripts associated with this gene.

View Full Product Details