Product Details
- SNP ID
-
rs2541955
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:21029667 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GATGGTAGTGGGGGAAGGGGAGGCA[C/G]CTGCCTGGGCCGAGTGTGAGTGGGT
- Phenotype
-
MIM: 608077
MIM: 603752
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
MIR649
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs111283358] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MIR649
- Gene Name
- microRNA 649
There are no transcripts associated with this gene.
- Gene
- P2RX6
- Gene Name
- purinergic receptor P2X 6
There are no transcripts associated with this gene.
- Gene
- SLC7A4
- Gene Name
- solute carrier family 7 member 4
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_004173.2 |
|
Intron |
|
|
NP_004164.2 |
View Full Product Details