Product Details

SNP ID: rs6883035
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:140694298 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACCTTACTGTATCCTTTTGAGTACT[A/G]GAGCCTGACCTGTCTCTTTCCAAAT
Phenotype: MIM: 142810 MIM: 600783
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HARS PubMed Links

Gene Details

Gene: HARS
Gene Name: histidyl-tRNA synthetase

There are no transcripts associated with this gene.

Gene: HARS2
Gene Name: histidyl-tRNA synthetase 2, mitochondrial

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278731.1		Intron			NP_001265660.1
NM_001278732.1		Intron			NP_001265661.1
NM_012208.3		Intron			NP_036340.1
XM_011537619.1		Intron			XP_011535921.1
XM_011537620.1		Intron			XP_011535922.1
XM_017009287.1		Intron			XP_016864776.1
XM_017009288.1		Intron			XP_016864777.1
XM_017009289.1		Intron			XP_016864778.1
XM_017009290.1		Intron			XP_016864779.1
XM_017009291.1		Intron			XP_016864780.1
XM_017009292.1		Intron			XP_016864781.1

Gene: ZMAT2
Gene Name: zinc finger matrin-type 2

There are no transcripts associated with this gene.

View Full Product Details