Product Details

SNP ID: rs563037333
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:42704089 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCAGGTAAAGACGCTCAGCACTCCT[A/G]TTACAAACAGAACCCAGAAATGGAG
Phenotype: MIM: 602346 MIM: 601674
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CNTNAP1 PubMed Links

Gene Details

Gene: CNTNAP1
Gene Name: contactin associated protein 1

There are no transcripts associated with this gene.

Gene: EZH1
Gene Name: enhancer of zeste 1 polycomb repressive complex 2 subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321079.1		Intron			NP_001308008.1
NM_001321081.1		Intron			NP_001308010.1
NM_001321082.1		Intron			NP_001308011.1
NM_001991.4		Intron			NP_001982.2
XM_005257145.2		Intron			XP_005257202.1
XM_011524517.2		Intron			XP_011522819.1
XM_017024350.1		Intron			XP_016879839.1
XM_017024351.1		Intron			XP_016879840.1
XM_017024352.1		Intron			XP_016879841.1

Gene: MIR6780A
Gene Name: microRNA 6780a

There are no transcripts associated with this gene.

View Full Product Details