Product Details

SNP ID: rs2868362
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45891004 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGCAGCAGCCATCTCTCGGCCATA[A/G]GGCAGGCCAGCTGGCGCCGGGGGCT
Phenotype: MIM: 613111 MIM: 608597 MIM: 172425
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CTSA PubMed Links

Gene Details

Gene: CTSA
Gene Name: cathepsin A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000308.3	861	UTR 5			NP_000299.2
NM_001127695.2	861	UTR 5			NP_001121167.1
NM_001167594.2	861	UTR 5			NP_001161066.1

Gene: NEURL2
Gene Name: neuralized E3 ubiquitin protein ligase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278535.1	861	UTR 5			NP_001265464.1
NM_080749.3	861	UTR 5			NP_542787.1

Gene: PLTP
Gene Name: phospholipid transfer protein

There are no transcripts associated with this gene.

Gene: SPATA25
Gene Name: spermatogenesis associated 25

There are no transcripts associated with this gene.

Gene: ZSWIM1
Gene Name: zinc finger SWIM-type containing 1

There are no transcripts associated with this gene.

View Full Product Details