Product Details

SNP ID

rs34156165

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.17:40019868 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ACACACTCCTCCATGAACCACTGCA[C/T]GAACTGGGTGTGGGGGCCAGCGGTG

Phenotype

MIM: 138970 MIM: 607000

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

CSF3 PubMed Links

Gene Details

Gene

CSF3

Gene Name

colony stimulating factor 3

There are no transcripts associated with this gene.

Gene

MED24

Gene Name

mediator complex subunit 24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001079518.1	2953	Missense Mutation	ATG,GTG	M911V	NP_001072986.1
NM_001267797.1	2953	Missense Mutation	ATG,GTG	M911V	NP_001254726.1
NM_014815.3	2953	Missense Mutation	ATG,GTG	M924V	NP_055630.2
XM_005257874.2	2953	Missense Mutation	ATG,GTG	M949V	XP_005257931.1
XM_006722204.2	2953	Missense Mutation	ATG,GTG	M1004V	XP_006722267.1
XM_006722206.2	2953	Missense Mutation	ATG,GTG	M979V	XP_006722269.1
XM_006722207.2	2953	Missense Mutation	ATG,GTG	M979V	XP_006722270.1
XM_011525529.2	2953	Missense Mutation	ATG,GTG	M1023V	XP_011523831.1
XM_011525530.2	2953	Missense Mutation	ATG,GTG	M986V	XP_011523832.1
XM_011525531.2	2953	Missense Mutation	ATG,GTG	M967V	XP_011523833.1
XM_011525532.2	2953	Missense Mutation	ATG,GTG	M998V	XP_011523834.1
XM_011525533.2	2953	Missense Mutation	ATG,GTG	M998V	XP_011523835.1
XM_011525534.2	2953	Missense Mutation	ATG,GTG	M955V	XP_011523836.1
XM_011525535.2	2953	Missense Mutation	ATG,GTG	M954V	XP_011523837.1
XM_011525536.2	2953	Missense Mutation	ATG,GTG	M943V	XP_011523838.1
XM_011525538.2	2953	Missense Mutation	ATG,GTG	M882V	XP_011523840.1
XM_017025458.1	2953	Missense Mutation	ATG,GTG	M986V	XP_016880947.1
XM_017025459.1	2953	Missense Mutation	ATG,GTG	M967V	XP_016880948.1
XM_017025460.1	2953	Missense Mutation	ATG,GTG	M943V	XP_016880949.1
XM_017025461.1	2953	Missense Mutation	ATG,GTG	M968V	XP_016880950.1
XM_017025462.1	2953	Missense Mutation	ATG,GTG	M942V	XP_016880951.1
XM_017025463.1	2953	Missense Mutation	ATG,GTG	M942V	XP_016880952.1
XM_017025464.1	2953	Missense Mutation	ATG,GTG	M936V	XP_016880953.1
XM_017025465.1	2953	Missense Mutation	ATG,GTG	M961V	XP_016880954.1
XM_017025466.1	2953	Missense Mutation	ATG,GTG	M924V	XP_016880955.1
XM_017025467.1	2953	Missense Mutation	ATG,GTG	M923V	XP_016880956.1
XM_017025468.1	2953	Missense Mutation	ATG,GTG	M923V	XP_016880957.1
XM_017025469.1	2953	Missense Mutation	ATG,GTG	M870V	XP_016880958.1
XM_017025470.1	2953	Missense Mutation	ATG,GTG	M827V	XP_016880959.1
XM_017025471.1	2953	Intron			XP_016880960.1

Gene

MIR6884

Gene Name

microRNA 6884

There are no transcripts associated with this gene.

Gene

SNORD124

Gene Name

small nucleolar RNA, C/D box 124

There are no transcripts associated with this gene.

View Full Product Details