Product Details

SNP ID: rs6740454
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:70288042 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTCCAAAAGAAAAATGAAATCTCC[A/C]AGAGAACTCTTGTATCTTTACTTAC
Phenotype: MIM: 616275 MIM: 610995 MIM: 603542
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FAM136A PubMed Links

Gene Details

Gene: FAM136A
Gene Name: family with sequence similarity 136 member A

There are no transcripts associated with this gene.

Gene: PCYOX1
Gene Name: prenylcysteine oxidase 1

There are no transcripts associated with this gene.

Gene: SNRPG
Gene Name: small nuclear ribonucleoprotein polypeptide G

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317165.1		Intron			NP_001304094.1
NM_001317166.1		Intron			NP_001304095.1
NM_001317167.1		Intron			NP_001304096.1
NM_001317168.1		Intron			NP_001304097.1
NM_001317169.1		Intron			NP_001304098.1
NM_001317171.1		Intron			NP_001304100.1
NM_003096.3		Intron			NP_003087.1
XM_017004774.1		Intron			XP_016860263.1

View Full Product Details