Product Details
- SNP ID
-
rs116430791
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:123940038 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ACGCTCATTATGAATCAGACTGTCT[G/T]TGCACTCCTTATGGCAGCCTCCTGG
- Phenotype
-
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
OR4D5
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs201503357] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- OR4D5
- Gene Name
- olfactory receptor family 4 subfamily D member 5
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_001001965.1 |
422 |
Missense Mutation |
TGT,TTT |
C141F |
NP_001001965.1 |
- Gene
- OR6T1
- Gene Name
- olfactory receptor family 6 subfamily T member 1
There are no transcripts associated with this gene.
View Full Product Details