Product Details

SNP ID: rs11901826
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:27278175 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAACTGCTGGACTGAGGCCATTCTC[A/G]CCTACCTTTTAGACACTTGTCATCC
Phenotype: MIM: 613946 MIM: 602878 MIM: 606474
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: DNAJC5G PubMed Links

Gene Details

Gene: DNAJC5G
Gene Name: DnaJ heat shock protein family (Hsp40) member C5 gamma

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001303127.1		Intron			NP_001290056.1
NM_001303128.1		Intron			NP_001290057.1
NM_173650.2		Intron			NP_775921.1
XM_006711995.3		Intron			XP_006712058.1
XM_017003872.1		Intron			XP_016859361.1
XM_017003873.1		Intron			XP_016859362.1
XM_017003874.1		Intron			XP_016859363.1

Gene: SLC30A3
Gene Name: solute carrier family 30 member 3

There are no transcripts associated with this gene.

Gene: TRIM54
Gene Name: tripartite motif containing 54

There are no transcripts associated with this gene.

View Full Product Details