Product Details

SNP ID

rs10200539

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.2:209426003 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AAAGAACCCTTCCTTCAAGAAAAAA[A/G]GCATTTTTCTCATTCAGTAAGGATT

Phenotype

MIM: 157130

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

MAP2 PubMed Links

Additional Information

For this assay, SNP(s) [rs189726564] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

MAP2

Gene Name

microtubule associated protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039538.1		Intron			NP_001034627.1
NM_002374.3		Intron			NP_002365.3
NM_031845.2		Intron			NP_114033.2
NM_031847.2		Intron			NP_114035.2
XM_005246555.1		Intron			XP_005246612.1
XM_005246565.1		Intron			XP_005246622.1
XM_005246566.1		Intron			XP_005246623.1
XM_006712532.1		Intron			XP_006712595.1
XM_011511186.1		Intron			XP_011509488.1
XM_011511187.1		Intron			XP_011509489.1
XM_011511188.1		Intron			XP_011509490.1
XM_011511190.1		Intron			XP_011509492.1
XM_011511191.1		Intron			XP_011509493.1
XM_011511192.1		Intron			XP_011509494.1
XM_011511193.1		Intron			XP_011509495.1
XM_011511195.1		Intron			XP_011509497.1
XM_011511196.2		Intron			XP_011509498.1
XM_011511197.2		Intron			XP_011509499.1
XM_017004111.1		Intron			XP_016859600.1
XM_017004112.1		Intron			XP_016859601.1
XM_017004113.1		Intron			XP_016859602.1
XM_017004114.1		Intron			XP_016859603.1
XM_017004115.1		Intron			XP_016859604.1
XM_017004116.1		Intron			XP_016859605.1
XM_017004117.1		Intron			XP_016859606.1
XM_017004118.1		Intron			XP_016859607.1
XM_017004119.1		Intron			XP_016859608.1
XM_017004120.1		Intron			XP_016859609.1
XM_017004121.1		Intron			XP_016859610.1
XM_017004122.1		Intron			XP_016859611.1
XM_017004123.1		Intron			XP_016859612.1
XM_017004124.1		Intron			XP_016859613.1
XM_017004125.1		Intron			XP_016859614.1
XM_017004126.1		Intron			XP_016859615.1
XM_017004127.1		Intron			XP_016859616.1
XM_017004128.1		Intron			XP_016859617.1
XM_017004129.1		Intron			XP_016859618.1
XM_017004130.1		Intron			XP_016859619.1
XM_017004131.1		Intron			XP_016859620.1
XM_017004132.1		Intron			XP_016859621.1
XM_017004133.1		Intron			XP_016859622.1
XM_017004134.1		Intron			XP_016859623.1
XM_017004135.1		Intron			XP_016859624.1
XM_017004136.1		Intron			XP_016859625.1
XM_017004137.1		Intron			XP_016859626.1
XM_017004138.1		Intron			XP_016859627.1
XM_017004139.1		Intron			XP_016859628.1
XM_017004140.1		Intron			XP_016859629.1

View Full Product Details