Product Details

SNP ID: hCV26928088
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:67678217 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGGCAAGGCTGGAAGGTTTTGCT[C/T]TCTTTGTGCTAAAGGTTTTGAAAAC
Phenotype: MIM: 603930 MIM: 607849 MIM: 603207
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GPHN PubMed Links

Gene Details

Gene: GPHN
Gene Name: gephyrin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001024218.1	1151	Intron			NP_001019389.1
NM_020806.4	1151	Intron			NP_065857.1

Gene: RDH11
Gene Name: retinol dehydrogenase 11 (all-trans/9-cis/11-cis)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001252650.1	1151	UTR 3			NP_001239579.1
NM_016026.3	1151	UTR 3			NP_057110.3

Gene: VTI1B
Gene Name: vesicle transport through interaction with t-SNAREs 1B

There are no transcripts associated with this gene.

View Full Product Details