Product Details

SNP ID: rs2686812
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100573544 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGCCTCCGTAGAGCGCGTGGTGAA[C/G]GCATGGAGGCCCCCAGTCGCTGTCC
Phenotype: MIM: 604019 MIM: 609097
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: AGFG2 PubMed Links

Gene Details

Gene: AGFG2
Gene Name: ArfGAP with FG repeats 2

There are no transcripts associated with this gene.

Gene: FBXO24
Gene Name: F-box protein 24

There are no transcripts associated with this gene.

Gene: LRCH4
Gene Name: leucine rich repeats and calponin homology domain containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001289934.1		Intron			NP_001276863.1
NM_002319.4		Intron			NP_002310.2

Gene: SAP25
Gene Name: Sin3A associated protein 25

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001168682.1		Intron			NP_001162153.1
XM_005250096.3		Intron			XP_005250153.1
XM_006715822.3		Intron			XP_006715885.1

Gene: ZASP
Gene Name: ZO-2 associated speckle protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001289933.1		Intron			NP_001276862.1

View Full Product Details