Product Details

SNP ID: rs3185692
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:1982858 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGGCAGGCACAGGCAGGGGACAA[G/T]GCCCACCGTCTCCCACGCTCTGGTG
Phenotype: MIM: 606026 MIM: 602952
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: MIR943 PubMed Links

Gene Details

Gene: MIR943
Gene Name: microRNA 943

There are no transcripts associated with this gene.

Gene: NELFA
Gene Name: negative elongation factor complex member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005663.4	2324	UTR 3			NP_005654.3
XM_017008589.1	2324	UTR 3			XP_016864078.1

Gene: SCARNA22
Gene Name: small Cajal body-specific RNA 22

There are no transcripts associated with this gene.

Gene: WHSC1
Gene Name: Wolf-Hirschhorn syndrome candidate 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042424.2	2324	Intron			NP_001035889.1
NM_007331.1	2324	Intron			NP_015627.1
NM_133330.2	2324	Intron			NP_579877.1
NM_133331.2	2324	Intron			NP_579878.1
NM_133334.2	2324	Intron			NP_579889.1
NM_133335.3	2324	Intron			NP_579890.1
XM_005248001.3	2324	Intron			XP_005248058.1
XM_005248002.2	2324	Intron			XP_005248059.1
XM_005248005.2	2324	Intron			XP_005248062.1
XM_006713914.3	2324	Intron			XP_006713977.1
XM_011513557.2	2324	Intron			XP_011511859.1
XM_011513560.2	2324	Intron			XP_011511862.1
XM_017008587.1	2324	Intron			XP_016864076.1
XM_017008588.1	2324	Intron			XP_016864077.1

View Full Product Details