Product Details

SNP ID: hCV27834433
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:109440985 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAGTCGGGCCCGACCTGAGCCACGC[A/G]GGCTTGGTGCCCACCTGTGCGCGCC
Phenotype: MIM: 607129 MIM: 603498
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MICAL1 PubMed Links

Gene Details

Gene: MICAL1
Gene Name: microtubule associated monooxygenase, calponin and LIM domain containing 1

There are no transcripts associated with this gene.

Gene: PPIL6
Gene Name: peptidylprolyl isomerase like 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001111298.2	187	UTR 5			NP_001104768.2
NM_001286360.1	187	UTR 5			NP_001273289.1
NM_001286361.1	187	UTR 5			NP_001273290.1
NM_173672.4	187	UTR 5			NP_775943.1

Gene: SMPD2
Gene Name: sphingomyelin phosphodiesterase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003080.2	187	UTR 5			NP_003071.2

View Full Product Details