Product Details
- SNP ID
-
rs192834662
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.7:27188678 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGCTAAAGCCGCCCCGGAAGGCCAA[A/G]TCCGAGTTCCATTTCTTGAAGAGGC
- Phenotype
-
MIM: 142957
MIM: 142958
MIM: 607530
MIM: 142959
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
HOXA10
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs141075420] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- HOXA10
- Gene Name
- homeobox A10
There are no transcripts associated with this gene.
- Gene
- HOXA10-HOXA9
- Gene Name
- HOXA10-HOXA9 readthrough
There are no transcripts associated with this gene.
- Gene
- HOXA11
- Gene Name
- homeobox A11
There are no transcripts associated with this gene.
- Gene
- HOXA11-AS
- Gene Name
- HOXA11 antisense RNA
There are no transcripts associated with this gene.
- Gene
- HOXA13
- Gene Name
- homeobox A13
There are no transcripts associated with this gene.
View Full Product Details