Product Details

SNP ID: rs6062296
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:63660784 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CATTAGAGGGGCAGCCGGTGGCCAG[C/T]CTCACTTGGAAGGTCTTTGAACCTC
Phenotype: MIM: 608833 MIM: 608362
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: RTEL1 PubMed Links

Gene Details

Gene: RTEL1
Gene Name: regulator of telomere elongation helicase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001283009.1		Intron			NP_001269938.1
NM_001283010.1		Intron			NP_001269939.1
NM_016434.3		Intron			NP_057518.1
NM_032957.4		Intron			NP_116575.3

Gene: RTEL1-TNFRSF6B
Gene Name: RTEL1-TNFRSF6B readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: STMN3
Gene Name: stathmin 3

There are no transcripts associated with this gene.

View Full Product Details