Product Details

SNP ID: rs9892087
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:30117832 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACATTTCTGAACTTTTCATTTACTT[A/C]TCTTCTTTGATAAAAATGGTATTCG
Phenotype: MIM: 616173
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: EFCAB5 PubMed Links

Gene Details

Gene: EFCAB5
Gene Name: EF-hand calcium binding domain 5

There are no transcripts associated with this gene.

Gene: MIR3184
Gene Name: microRNA 3184

There are no transcripts associated with this gene.

Gene: MIR423
Gene Name: microRNA 423

There are no transcripts associated with this gene.

Gene: NSRP1
Gene Name: nuclear speckle splicing regulatory protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001261467.1		Intron			NP_001248396.1
NM_032141.3		Intron			NP_115517.1
XM_011525345.2		Intron			XP_011523647.1
XM_017025209.1		Intron			XP_016880698.1
XM_017025210.1		Intron			XP_016880699.1
XM_017025211.1		Intron			XP_016880700.1
XM_017025212.1		Intron			XP_016880701.1
XM_017025213.1		Intron			XP_016880702.1
XM_017025214.1		Intron			XP_016880703.1
XM_017025215.1		Intron			XP_016880704.1

View Full Product Details