Product Details

SNP ID: rs13262354
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.8:90623503 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATGCTGAAGAAAAGAAAAACCACA[A/G]CCACAGATTGGTATTTTAGAAACAG
Phenotype
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: TMEM64 PubMed Links
Additional Information: For this assay, SNP(s) [rs535554707] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001008495.3	3311	UTR 3			NP_001008495.2
NM_001146273.1	3311	UTR 3			NP_001139745.1