Product Details

SNP ID: rs17107484
Assay Type: Functionally tested
NCBI dbSNP Submissions: 25
Location: Chr.1:52944716 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TAATGATGTTTGAAATTAACTCTGG[A/G]GATTGACTAGTAATAAGAAATCTGG
Phenotype: MIM: 184755
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR1273G PubMed Links

Gene Details

Gene: MIR1273G
Gene Name: microRNA 1273g

There are no transcripts associated with this gene.

Gene: MIR5095
Gene Name: microRNA 5095

There are no transcripts associated with this gene.

Gene: SCP2
Gene Name: sterol carrier protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001007098.2		Intron			NP_001007099.1
NM_001007099.2		Intron			NP_001007100.1
NM_001007100.2		Intron			NP_001007101.1
NM_001007250.2		Intron			NP_001007251.1
NM_001193599.1		Intron			NP_001180528.1
NM_001193600.1		Intron			NP_001180529.1
NM_001193617.1		Intron			NP_001180546.1
NM_002979.4		Intron			NP_002970.2
XM_005271103.4		Intron			XP_005271160.1
XM_011541935.2		Intron			XP_011540237.1
XM_017002045.1		Intron			XP_016857534.1
XM_017002046.1		Intron			XP_016857535.1

View Full Product Details