Product Details

SNP ID: rs17163868
Assay Type: Functionally tested
NCBI dbSNP Submissions: 50
Location: Chr.1:26321890 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TACCTGGCAGCATATTAGAAAATAG[C/T]TTATGTTACAACAAAAACCCTATAA
Phenotype: MIM: 114280 MIM: 609151
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AIM1L PubMed Links

Gene Details

Gene: AIM1L
Gene Name: absent in melanoma 1-like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039775.3	5200	UTR 3			NP_001034864.2
XM_005245918.2	5200	UTR 3			XP_005245975.1
XM_011541672.1	5200	UTR 3			XP_011539974.1
XM_011541673.2	5200	UTR 3			XP_011539975.1

Gene: CD52
Gene Name: CD52 molecule

There are no transcripts associated with this gene.

Gene: UBXN11
Gene Name: UBX domain protein 11

There are no transcripts associated with this gene.

View Full Product Details