Product Details

SNP ID: rs28399994
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31764524 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCAAGGGGCCAAGAGGCCCTACCC[A/G]TGTCTAAACCCTCCTCTCACTCCCC
Phenotype: MIM: 603382 MIM: 609693
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MSH5 PubMed Links

Gene Details

Gene: MSH5
Gene Name: mutS homolog 5

There are no transcripts associated with this gene.

Gene: MSH5-SAPCD1
Gene Name: MSH5-SAPCD1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: SAPCD1
Gene Name: suppressor APC domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039651.1	3606	Missense Mutation	CAT,CGT	H177R	NP_001034740.1

Gene: SAPCD1-AS1
Gene Name: SAPCD1 antisense RNA 1

There are no transcripts associated with this gene.

Gene: VWA7
Gene Name: von Willebrand factor A domain containing 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025258.2	3606	Intron			NP_079534.2
XM_005249427.2	3606	UTR 3			XP_005249484.1
XM_017011327.1	3606	UTR 3			XP_016866816.1
XM_017011328.1	3606	UTR 3			XP_016866817.1
XM_017011329.1	3606	UTR 3			XP_016866818.1

View Full Product Details