Product Details

SNP ID: rs9273930
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.6:32661998 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCACGGTGATGGGGCTCTGGAGGCT[A/G]GGGTGCTCCACGTGGCAGGTGTAGA
Phenotype: MIM: 146880 MIM: 604305
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: HLA-DQA1 PubMed Links

Gene Details

Gene: HLA-DQA1
Gene Name: major histocompatibility complex, class II, DQ alpha 1

There are no transcripts associated with this gene.

Gene: HLA-DQB1
Gene Name: major histocompatibility complex, class II, DQ beta 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243961.1	712	Silent Mutation	CCC,CCT	P210P	NP_001230890.1
NM_001243962.1	712	Silent Mutation	CCC,CCT	P210P	NP_001230891.1
NM_002123.4	712	Silent Mutation	CCC,CCT	P210P	NP_002114.3

Gene: HLA-DQB1-AS1
Gene Name: HLA-DQB1 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details