Product Details

SNP ID
rs28722492
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.15:28924253 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TGATGTCATCTGTAGGTTTTTTTTT[A/T]AAAAAAGTGGGTAAAATTCATATAA
Phenotype
MIM: 602712
Polymorphism
A/T, Transversion Substitution
Allele Nomenclature
Literature Links
APBA2 PubMed Links
Additional Information
For this assay, SNP(s) [rs189739855] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
APBA2
Gene Name
amyloid beta precursor protein binding family A member 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001130414.1 Intron NP_001123886.1
NM_005503.3 Intron NP_005494.2
XM_011521488.2 Intron XP_011519790.1
XM_011521489.2 Intron XP_011519791.1
XM_011521490.2 Intron XP_011519792.1
XM_011521491.1 Intron XP_011519793.1
XM_011521492.2 Intron XP_011519794.1
XM_011521493.2 Intron XP_011519795.1
XM_011521494.2 Intron XP_011519796.1
XM_011521495.1 Intron XP_011519797.1
XM_011521496.1 Intron XP_011519798.1
XM_017022101.1 Intron XP_016877590.1
XM_017022102.1 Intron XP_016877591.1
XM_017022103.1 Intron XP_016877592.1
XM_017022104.1 Intron XP_016877593.1
XM_017022105.1 Intron XP_016877594.1
XM_017022106.1 Intron XP_016877595.1
XM_017022107.1 Intron XP_016877596.1
XM_017022108.1 Intron XP_016877597.1
XM_017022109.1 Intron XP_016877598.1
XM_017022110.1 Intron XP_016877599.1
XM_017022111.1 Intron XP_016877600.1
XM_017022112.1 Intron XP_016877601.1
XM_017022113.1 Intron XP_016877602.1
XM_017022114.1 Intron XP_016877603.1
XM_017022115.1 Intron XP_016877604.1
XM_017022116.1 Intron XP_016877605.1
XM_017022117.1 Intron XP_016877606.1

View Full Product Details