Product Details

SNP ID

rs15887

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.4:53459349 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGTGAAGAAGGAGATAGTCACAGGA[A/G]ACACAAACACAAAAAATCTAAAAGA

Phenotype

MIM: 607686 MIM: 609732

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

FIP1L1 PubMed Links

Gene Details

Gene

FIP1L1

Gene Name

factor interacting with PAPOLA and CPSF1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001134937.1	4249	Missense Mutation	AAA,AGA	K556R	NP_001128409.1
NM_001134938.1	4249	Missense Mutation	AAA,AGA	K488R	NP_001128410.1
NM_030917.3	4249	Missense Mutation	AAA,AGA	K562R	NP_112179.2
XM_005265769.4	4249	Missense Mutation	AAA,AGA	K571R	XP_005265826.1
XM_005265773.4	4249	Missense Mutation	AAA,AGA	K548R	XP_005265830.1
XM_005265774.4	4249	Missense Mutation	AAA,AGA	K539R	XP_005265831.1
XM_005265778.4	4249	Missense Mutation	AAC,GAC	N500D	XP_005265835.1
XM_005265779.4	4249	Missense Mutation	AAC,GAC	N491D	XP_005265836.1
XM_005265781.4	4249	Missense Mutation	AAA,AGA	K512R	XP_005265838.1
XM_005265782.4	4249	Missense Mutation	AAA,AGA	K503R	XP_005265839.1
XM_017008662.1	4249	Missense Mutation	AAA,AGA	K547R	XP_016864151.1
XM_017008663.1	4249	Missense Mutation	AAA,AGA	K535R	XP_016864152.1
XM_017008664.1	4249	Missense Mutation	AAA,AGA	K533R	XP_016864153.1
XM_017008665.1	4249	Missense Mutation	AAA,AGA	K526R	XP_016864154.1
XM_017008666.1	4249	Missense Mutation	AAA,AGA	K524R	XP_016864155.1
XM_017008667.1	4249	Missense Mutation	AAA,AGA	K520R	XP_016864156.1
XM_017008668.1	4249	Missense Mutation	AAA,AGA	K511R	XP_016864157.1
XM_017008669.1	4249	Missense Mutation	AAA,AGA	K497R	XP_016864158.1
XM_017008670.1	4249	Missense Mutation	AAC,GAC	N468D	XP_016864159.1
XM_017008671.1	4249	Missense Mutation	AAC,GAC	N441D	XP_016864160.1

Gene

LNX1

Gene Name

ligand of numb-protein X 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001126328.2	4249	Intron			NP_001119800.1
NM_032622.2	4249	Intron			NP_116011.2
XM_005265785.4	4249	UTR 3			XP_005265842.1
XM_017008776.1	4249	UTR 3			XP_016864265.1

View Full Product Details