Product Details

SNP ID: rs28371983
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:137232292 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AACTCCGCCATGCAGGCCCCCTCTG[G/T]GGAGACACGTGTCCCTCAACCGGGT
Phenotype: MIM: 609826 MIM: 602660
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CYSRT1 PubMed Links

Gene Details

Gene: CYSRT1
Gene Name: cysteine rich tail 1

There are no transcripts associated with this gene.

Gene: RNF224
Gene Name: ring finger protein 224

There are no transcripts associated with this gene.

Gene: SLC34A3
Gene Name: solute carrier family 34 member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001177316.1		Intron			NP_001170787.1
NM_001177317.1		Intron			NP_001170788.1
NM_080877.2		Intron			NP_543153.1
XM_011518257.2		Intron			XP_011516559.1
XM_011518258.1		Intron			XP_011516560.1
XM_011518259.1		Intron			XP_011516561.1
XM_011518260.1		Intron			XP_011516562.1
XM_011518261.2		Intron			XP_011516563.1
XM_017014290.1		Intron			XP_016869779.1
XM_017014291.1		Intron			XP_016869780.1
XM_017014292.1		Intron			XP_016869781.1

Gene: TUBB4B
Gene Name: tubulin beta 4B class IVb

There are no transcripts associated with this gene.

View Full Product Details