Product Details

SNP ID: rs72845730
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.6:32558954 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGGCACATTTTCAGGTTTAGGAAAT[A/C]CCATGTACAAAAGCTTGAATTGATG
Phenotype
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: HLA-DRB6 PubMed Links
Additional Information: For this assay, SNP(s) [rs372319444,rs567179242] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: HLA-DRB6
Gene Name: major histocompatibility complex, class II, DR beta 6 (pseudogene)

There are no transcripts associated with this gene.