Product Details

SNP ID: rs74154666
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:100526499 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATACACATGACATGCCAAGAAACA[C/G]GTGTGGGGGATGTATCCACACGGTT
Phenotype: MIM: 606615 MIM: 602140 MIM: 610258
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: HIF1AN PubMed Links

Gene Details

Gene: HIF1AN
Gene Name: hypoxia inducible factor 1 alpha subunit inhibitor

There are no transcripts associated with this gene.

Gene: NDUFB8
Gene Name: NADH:ubiquinone oxidoreductase subunit B8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284367.1	440	Missense Mutation	CCT,CGT	P123R	NP_001271296.1
NM_001284368.1	440	Intron			NP_001271297.1
NM_005004.3	440	Missense Mutation	CCT,CGT	P123R	NP_004995.1

Gene: SEC31B
Gene Name: SEC31 homolog B, COPII coat complex component

There are no transcripts associated with this gene.

View Full Product Details