Product Details

SNP ID: rs1790761
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:67454383 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTTTAGTTTGGTGCCCTCCGTACCC[C/T]CAGGGTTCCTCCTCAGGCTGACCCC
Phenotype: MIM: 608965
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CABP4 PubMed Links

Gene Details

Gene: CABP4
Gene Name: calcium binding protein 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300895.1		Intron			NP_001287824.1
NM_001300896.1		Intron			NP_001287825.1
NM_145200.3		Intron			NP_660201.1
XM_005274114.3		Intron			XP_005274171.2
XM_011545181.2		Intron			XP_011543483.1
XM_011545182.2		Intron			XP_011543484.1
XM_011545183.2		Intron			XP_011543485.1
XM_017018025.1		Intron			XP_016873514.1

Gene: GPR152
Gene Name: G protein-coupled receptor 152

There are no transcripts associated with this gene.

Gene: TMEM134
Gene Name: transmembrane protein 134

There are no transcripts associated with this gene.

View Full Product Details