Product Details

SNP ID: rs3007030
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:49619845 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TTGATTGGCTATACATCATTCTTTT[C/T]ATGACAAATTCCAGGAACGCGGACA
Phenotype: MIM: 612517 MIM: 609193 MIM: 602616 MIM: 180469
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DNAAF2 PubMed Links

Gene Details

Gene: DNAAF2
Gene Name: dynein axonemal assembly factor 2

There are no transcripts associated with this gene.

Gene: LRR1
Gene Name: leucine rich repeat protein 1

There are no transcripts associated with this gene.

Gene: MGAT2
Gene Name: mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_002408.3		Intron			NP_002399.1

Gene: RPL36AL
Gene Name: ribosomal protein L36a like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001.4		Intron			NP_000992.1

View Full Product Details