Product Details

SNP ID: rs13259546
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.8:28497696 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: AGAATGATGGAATGGAGCCCTTTCT[G/T]TAGAGAAAGTGTGAATTGGAATAGA
Phenotype: MIM: 608519 MIM: 606143
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: FBXO16 PubMed Links

Gene Details

Gene: FBXO16
Gene Name: F-box protein 16

There are no transcripts associated with this gene.

Gene: FZD3
Gene Name: frizzled class receptor 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017412.3		Intron			NP_059108.1
NM_145866.1		Intron			NP_665873.1
XM_017013841.1		Intron			XP_016869330.1
XM_017013842.1		Intron			XP_016869331.1
XM_017013843.1		Intron			XP_016869332.1
XM_017013844.1		Intron			XP_016869333.1

Gene: MIR4288
Gene Name: microRNA 4288

There are no transcripts associated with this gene.

View Full Product Details