Product Details

SNP ID: rs7115310
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.11:10575534 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CTCATTGAACAGGTGCCTGGTGACT[A/G]CCCCACACTGGTGAAAATCTGTGGG
Phenotype: MIM: 605702 MIM: 604673
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LYVE1 PubMed Links

Gene Details

Gene: LYVE1
Gene Name: lymphatic vessel endothelial hyaluronan receptor 1

There are no transcripts associated with this gene.

Gene: MRVI1
Gene Name: murine retrovirus integration site 1 homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098579.2	3870	UTR 3			NP_001092049.2
NM_001100163.2	3870	UTR 3			NP_001093633.1
NM_001100167.2	3870	UTR 3			NP_001093637.1
NM_001206880.1	3870	UTR 3			NP_001193809.1
NM_001206881.1	3870	UTR 3			NP_001193810.1
NM_130385.3	3870	UTR 3			NP_569056.4

Gene: MRVI1-AS1
Gene Name: MRVI1 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details