Product Details

SNP ID: rs11126435
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.2:74562573 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GCCCTGGTAGGGAGGGACTTCCTGC[A/T]TGAATCATCAATATCACAATGTACT
Phenotype: MIM: 602919 MIM: 607163
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: DOK1 PubMed Links

Gene Details

Gene: DOK1
Gene Name: docking protein 1

There are no transcripts associated with this gene.

Gene: LOXL3
Gene Name: lysyl oxidase like 3

There are no transcripts associated with this gene.

Gene: M1AP
Gene Name: meiosis 1 associated protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001281295.1		Intron			NP_001268224.1
NM_001281296.1		Intron			NP_001268225.1
NM_001321739.1		Intron			NP_001308668.1
NM_138804.4		Intron			NP_620159.2
XM_005264152.3		Intron			XP_005264209.1
XM_006711946.3		Intron			XP_006712009.1
XM_011532548.2		Intron			XP_011530850.1
XM_011532549.2		Intron			XP_011530851.1
XM_011532550.2		Intron			XP_011530852.1
XM_011532551.2		Intron			XP_011530853.1
XM_011532552.2		Intron			XP_011530854.1
XM_011532553.2		Intron			XP_011530855.1
XM_011532554.2		Intron			XP_011530856.1

View Full Product Details