Product Details

SNP ID: rs7154911
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24173816 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGCTCCTGCTGCAAACAGATTACTA[C/G]CATTTGGGGCTCTCCATGCCCCATT
Phenotype: MIM: 147574 MIM: 608193
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: IPO4 PubMed Links

Gene Details

Gene: IPO4
Gene Name: importin 4

There are no transcripts associated with this gene.

Gene: IRF9
Gene Name: interferon regulatory factor 9

There are no transcripts associated with this gene.

Gene: REC8
Gene Name: REC8 meiotic recombination protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001048205.1		Intron			NP_001041670.1
NM_005132.2		Intron			NP_005123.2
XM_011537421.1		Intron			XP_011535723.1
XM_017021841.1		Intron			XP_016877330.1

View Full Product Details