Product Details
- SNP ID
-
rs34882322
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.12:113467743 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TCGCCTCGGCCCCTCGGCTCCGGAG[C/T]CAGCCTCTGGCCGTTTGTCTGCCCG
- Phenotype
-
MIM: 605992
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
LHX5
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs116281146] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LHX5
- Gene Name
- LIM homeobox 5
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_022363.2 |
|
Intron |
|
|
NP_071758.1 |
- Gene
- LHX5-AS1
- Gene Name
- LHX5 antisense RNA 1 (head to head)
There are no transcripts associated with this gene.
View Full Product Details