Product Details

SNP ID: rs481285
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:117288354 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGCCATTAGAGAGGGTAGGAAGGCA[A/G]TGAAACCACTCTGAATTATGTAAAG
Phenotype: MIM: 604252 MIM: 614263
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BACE1 PubMed Links

Gene Details

Gene: BACE1
Gene Name: beta-secretase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001207048.1	3104	UTR 3			NP_001193977.1
NM_001207049.1	3104	UTR 3			NP_001193978.1
NM_012104.4	3104	UTR 3			NP_036236.1
NM_138971.3	3104	UTR 3			NP_620427.1
NM_138972.3	3104	UTR 3			NP_620428.1
NM_138973.3	3104	UTR 3			NP_620429.1

Gene: BACE1-AS
Gene Name: BACE1 antisense RNA

There are no transcripts associated with this gene.

Gene: RNF214
Gene Name: ring finger protein 214

There are no transcripts associated with this gene.

View Full Product Details