Product Details

SNP ID: rs1549723
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:43233375 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GACTTTGCAAGCCTATACCTCCTCA[A/C]CTCGGCTGAAAGCAGCCATGGACAA
Phenotype: MIM: 611800 MIM: 612053
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LINC01126 PubMed Links

Gene Details

Gene: LINC01126
Gene Name: long intergenic non-protein coding RNA 1126

There are no transcripts associated with this gene.

Gene: THADA
Gene Name: THADA, armadillo repeat containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001083953.1		Intron			NP_001077422.1
NM_001271643.1		Intron			NP_001258572.1
NM_001271644.1		Intron			NP_001258573.1
NM_022065.4		Intron			NP_071348.3
XM_006712061.3		Intron			XP_006712124.1
XM_006712062.1		Intron			XP_006712125.1
XM_006712063.1		Intron			XP_006712126.1
XM_006712064.2		Intron			XP_006712127.1
XM_006712065.1		Intron			XP_006712128.1
XM_006712066.1		Intron			XP_006712129.1
XM_006712067.1		Intron			XP_006712130.1
XM_006712068.3		Intron			XP_006712131.1
XM_006712069.3		Intron			XP_006712132.1
XM_011533015.2		Intron			XP_011531317.1
XM_017004674.1		Intron			XP_016860163.1
XM_017004675.1		Intron			XP_016860164.1

Gene: ZFP36L2
Gene Name: ZFP36 ring finger protein like 2

There are no transcripts associated with this gene.

View Full Product Details