Product Details

SNP ID

rs2015209

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.19:48204408 on Build GRCh38

Set Membership

HapMap

Context Sequence [VIC/FAM]

GTTTTCAAGGACAGGGAGTGTTTTG[A/G]TGAATTCCTATGTAATAAGGAGATT

Phenotype

MIM: 609051

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

C19orf68 PubMed Links

Additional Information

For this assay, SNP(s) [rs115132442] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

C19orf68

Gene Name

chromosome 19 open reading frame 68

There are no transcripts associated with this gene.

Gene

CARD8

Gene Name

caspase recruitment domain family member 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001184900.1		Intron			NP_001171829.1
NM_001184901.1		Intron			NP_001171830.1
NM_001184902.1		Intron			NP_001171831.1
NM_001184903.1		Intron			NP_001171832.1
NM_001184904.1		Intron			NP_001171833.1
NM_014959.3		Intron			NP_055774.2
XM_006723091.3		Intron			XP_006723154.1
XM_006723092.3		Intron			XP_006723155.1
XM_006723093.3		Intron			XP_006723156.1
XM_006723094.3		Intron			XP_006723157.1
XM_006723095.3		Intron			XP_006723158.1
XM_006723096.3		Intron			XP_006723159.1
XM_006723097.3		Intron			XP_006723160.1
XM_006723098.3		Intron			XP_006723161.1
XM_006723099.3		Intron			XP_006723162.1
XM_006723101.2		Intron			XP_006723164.1
XM_006723102.3		Intron			XP_006723165.1
XM_006723104.3		Intron			XP_006723167.1
XM_006723106.3		Intron			XP_006723169.1
XM_006723107.3		Intron			XP_006723170.1
XM_006723109.3		Intron			XP_006723172.1
XM_006723110.3		Intron			XP_006723173.1
XM_011526641.2		Intron			XP_011524943.1
XM_011526642.2		Intron			XP_011524944.1
XM_011526643.2		Intron			XP_011524945.1
XM_011526644.2		Intron			XP_011524946.1
XM_011526646.2		Intron			XP_011524948.1
XM_011526647.2		Intron			XP_011524949.1
XM_011526648.2		Intron			XP_011524950.1
XM_011526650.2		Intron			XP_011524952.1
XM_011526653.2		Intron			XP_011524955.1
XM_017026482.1		Intron			XP_016881971.1
XM_017026483.1		Intron			XP_016881972.1
XM_017026484.1		Intron			XP_016881973.1
XM_017026485.1		Intron			XP_016881974.1
XM_017026486.1		Intron			XP_016881975.1
XM_017026487.1		Intron			XP_016881976.1
XM_017026488.1		Intron			XP_016881977.1
XM_017026489.1		Intron			XP_016881978.1
XM_017026490.1		Intron			XP_016881979.1
XM_017026491.1		Intron			XP_016881980.1
XM_017026492.1		Intron			XP_016881981.1
XM_017026493.1		Intron			XP_016881982.1
XM_017026494.1		Intron			XP_016881983.1
XM_017026495.1		Intron			XP_016881984.1
XM_017026496.1		Intron			XP_016881985.1
XM_017026497.1		Intron			XP_016881986.1
XM_017026498.1		Intron			XP_016881987.1
XM_017026499.1		Intron			XP_016881988.1

View Full Product Details