Product Details

SNP ID

rs12541768

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.8:22055271 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGGGGCCTGGTGGGGGAGGGGCAAT[A/C]CAGGGGAGGAACCCAGGTCGGGGTG

Phenotype

MIM: 125305 MIM: 603725

Polymorphism

A/C, Transversion Substitution

Allele Nomenclature

Literature Links

DMTN PubMed Links

Additional Information

For this assay, SNP(s) [rs75866568] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

DMTN

Gene Name

dematin actin binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001114135.4		Intron			NP_001107607.1
NM_001114136.2		Intron			NP_001107608.1
NM_001114137.3		Intron			NP_001107609.1
NM_001114138.2		Intron			NP_001107610.1
NM_001114139.3		Intron			NP_001107611.1
NM_001302816.2		Intron			NP_001289745.1
NM_001302817.2		Intron			NP_001289746.1
NM_001323378.1		Intron			NP_001310307.1
NM_001323380.1		Intron			NP_001310309.1
NM_001323381.1		Intron			NP_001310310.1
NM_001323382.1		Intron			NP_001310311.1
NM_001323383.1		Intron			NP_001310312.1
NM_001323384.1		Intron			NP_001310313.1
NM_001323385.1		Intron			NP_001310314.1
NM_001323387.1		Intron			NP_001310316.1
NM_001323388.1		Intron			NP_001310317.1
NM_001323389.1		Intron			NP_001310318.1
NM_001323390.1		Intron			NP_001310319.1
NM_001323391.1		Intron			NP_001310320.1
NM_001323392.1		Intron			NP_001310321.1
NM_001323393.1		Intron			NP_001310322.1
NM_001323394.1		Intron			NP_001310323.1
NM_001323395.1		Intron			NP_001310324.1
NM_001323396.1		Intron			NP_001310325.1
NM_001323397.1		Intron			NP_001310326.1
NM_001323398.1		Intron			NP_001310327.1
NM_001323399.1		Intron			NP_001310328.1
NM_001323400.1		Intron			NP_001310329.1
NM_001323401.1		Intron			NP_001310330.1
NM_001978.4		Intron			NP_001969.2
XM_005273432.1		Intron			XP_005273489.1
XM_005273433.1		Intron			XP_005273490.1
XM_005273442.1		Intron			XP_005273499.1
XM_011544435.1		Intron			XP_011542737.1
XM_017013189.1		Intron			XP_016868678.1
XM_017013190.1		Intron			XP_016868679.1
XM_017013191.1		Intron			XP_016868680.1
XM_017013192.1		Intron			XP_016868681.1
XM_017013193.1		Intron			XP_016868682.1
XM_017013194.1		Intron			XP_016868683.1
XM_017013195.1		Intron			XP_016868684.1
XM_017013196.1		Intron			XP_016868685.1
XM_017013197.1		Intron			XP_016868686.1
XM_017013198.1		Intron			XP_016868687.1

Gene

FGF17

Gene Name

fibroblast growth factor 17

There are no transcripts associated with this gene.

View Full Product Details