Product Details
- SNP ID
-
rs34805135
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.2:148030752 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ATTTTTGATGAGAAAATATACTTAC[A/G]TATTGAAGTAAAAAATGACCCAGGA
- Phenotype
-
MIM: 611472
MIM: 603056
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
MBD5
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs76106164] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MBD5
- Gene Name
- methyl-CpG binding domain protein 5
- Gene
- ORC4
- Gene Name
- origin recognition complex subunit 4
There are no transcripts associated with this gene.
View Full Product Details