Product Details

SNP ID
rs1056994
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.3:11557862 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GTCTGCAGTCCAGTTGCAAGCACCT[A/G]AAATCTAGAGAGAGAAAGACCTATA
Phenotype
MIM: 608760
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
ATG7 PubMed Links
Additional Information
For this assay, SNP(s) [rs531867006] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ATG7
Gene Name
autophagy related 7
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001136031.2 2088 Intron NP_001129503.2
NM_001144912.1 2088 Intron NP_001138384.1
NM_006395.2 2088 Intron NP_006386.1
XM_006712931.3 2088 Intron XP_006712994.1
XM_006712932.3 2088 Intron XP_006712995.1
XM_006712933.3 2088 Intron XP_006712996.1
XM_011533277.2 2088 Intron XP_011531579.1
XM_011533278.2 2088 Intron XP_011531580.1
XM_011533279.2 2088 Intron XP_011531581.1
XM_011533280.2 2088 Intron XP_011531582.1
XM_011533281.2 2088 Intron XP_011531583.1
XM_011533282.2 2088 Intron XP_011531584.1
XM_011533283.2 2088 Intron XP_011531585.1
XM_011533284.2 2088 Intron XP_011531586.1
XM_011533285.2 2088 Intron XP_011531587.1
XM_011533286.2 2088 Intron XP_011531588.1
XM_017005542.1 2088 Intron XP_016861031.1
XM_017005543.1 2088 Intron XP_016861032.1
XM_017005544.1 2088 Intron XP_016861033.1
XM_017005545.1 2088 Intron XP_016861034.1
XM_017005546.1 2088 Intron XP_016861035.1
XM_017005547.1 2088 Intron XP_016861036.1
XM_017005548.1 2088 Intron XP_016861037.1
XM_017005549.1 2088 Intron XP_016861038.1
XM_017005550.1 2088 Intron XP_016861039.1
XM_017005551.1 2088 Intron XP_016861040.1
XM_017005552.1 2088 Intron XP_016861041.1
XM_017005553.1 2088 Intron XP_016861042.1
XM_017005554.1 2088 Intron XP_016861043.1
Gene
VGLL4
Gene Name
vestigial like family member 4
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001128219.2 2088 UTR 3 NP_001121691.1
NM_001128220.2 2088 UTR 3 NP_001121692.1
NM_001128221.2 2088 UTR 3 NP_001121693.1
NM_001284390.1 2088 UTR 3 NP_001271319.1
NM_001284391.1 2088 UTR 3 NP_001271320.1
NM_014667.3 2088 UTR 3 NP_055482.2
XM_011534267.2 2088 UTR 3 XP_011532569.1
XM_011534268.1 2088 UTR 3 XP_011532570.1
XM_011534269.1 2088 UTR 3 XP_011532571.1
XM_017007541.1 2088 UTR 3 XP_016863030.1
XM_017007542.1 2088 UTR 3 XP_016863031.1

View Full Product Details