Product Details

SNP ID: rs1059332
Assay Type: Functionally tested
NCBI dbSNP Submissions: 15
Location: Chr.1:6461443 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAAGTGGGCGCCGTGTCACGGGCC[A/G]CGCTGCAGGCGGCTGCGCAAGTCTT
Phenotype: MIM: 606351 MIM: 611101 MIM: 603366
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ESPN PubMed Links

Gene Details

Gene: ESPN
Gene Name: espin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_031475.2	1222	Intron			NP_113663.2
XM_005263501.2	1222	Intron			XP_005263558.1
XM_011542231.1	1222	Intron			XP_011540533.1
XM_011542232.1	1222	Intron			XP_011540534.1
XM_011542233.2	1222	Intron			XP_011540535.1
XM_011542236.2	1222	Intron			XP_011540538.1
XM_011542237.1	1222	Intron			XP_011540539.1
XM_011542238.2	1222	Intron			XP_011540540.1
XM_017002433.1	1222	Intron			XP_016857922.1
XM_017002434.1	1222	Intron			XP_016857923.1

Gene: PLEKHG5
Gene Name: pleckstrin homology and RhoGEF domain containing G5

There are no transcripts associated with this gene.

Gene: TNFRSF25
Gene Name: TNF receptor superfamily member 25

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039664.1	1222	Intron			NP_001034753.1
NM_003790.2	1222	Silent Mutation	CGC,CGT	R415R	NP_003781.1
NM_148965.1	1222	Silent Mutation	CGC,CGT	R424R	NP_683866.1
NM_148966.1	1222	Silent Mutation	CGC,CGT	R378R	NP_683867.1
NM_148967.1	1222	Silent Mutation	CGC,CGT	R370R	NP_683868.1
NM_148970.1	1222	Silent Mutation	CGC,CGT	R232R	NP_683871.1

View Full Product Details