Product Details

SNP ID: rs3848543
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.19:48638275 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CTGCGAGCGGGGAACCAGAATGTAC[C/T]AGGTCGAGAAGCACTGGGCTGAACC
Phenotype: MIM: 604644 MIM: 124097 MIM: 607092
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CA11 PubMed Links

Gene Details

Gene: CA11
Gene Name: carbonic anhydrase 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001217.4		Intron			NP_001208.2

Gene: DBP
Gene Name: D-box binding PAR bZIP transcription factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001352.4		Intron			NP_001343.2
XM_017026388.1		Intron			XP_016881877.1

Gene: SEC1P
Gene Name: secretory blood group 1, pseudogene

There are no transcripts associated with this gene.

Gene: SPHK2
Gene Name: sphingosine kinase 2

There are no transcripts associated with this gene.

View Full Product Details