Product Details

SNP ID: rs1533600
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.15:76217732 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAACTGGTCCAGCCACTTGTGCAAA[A/G]TATCAATTACCCAGTCTTCCAAGGG
Phenotype: MIM: 608053
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: ETFA PubMed Links
Additional Information: For this assay, SNP(s) [rs116724809] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000126.3		Intron			NP_000117.1
NM_001127716.1		Intron			NP_001121188.1