Product Details

SNP ID: rs139878
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.22:37965552 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: TTTATATTTTGAAAGAAAGCAGGCA[C/T]ATGCAGATCAGGTATTTTGCCACAT
Phenotype: MIM: 604414 MIM: 602229
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR6820 PubMed Links

Gene Details

Gene: MIR6820
Gene Name: microRNA 6820

There are no transcripts associated with this gene.

Gene: POLR2F
Gene Name: RNA polymerase II subunit F

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001301129.1		Intron			NP_001288058.1
NM_001301130.1		Intron			NP_001288059.1
NM_001301131.1		Intron			NP_001288060.1
NM_021974.4		Intron			NP_068809.1
XM_017028832.1		Intron			XP_016884321.1

Gene: SOX10
Gene Name: SRY-box 10

There are no transcripts associated with this gene.

View Full Product Details