Product Details

SNP ID: rs6008736
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.22:48492795 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: TGAGGGTTGTTGGATGGTTGGTAAT[A/G]AGTTGACTTGCATGATGATGAGCTT
Phenotype
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: FAM19A5 PubMed Links
Additional Information: For this assay, SNP(s) [rs75476729] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: FAM19A5
Gene Name: family with sequence similarity 19 member A5, C-C motif chemokine like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001082967.2		Intron			NP_001076436.1
NM_015381.6		Intron			NP_056196.2