Product Details

SNP ID: rs6546029
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:63842598 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GGAAGCGGGAGGACTGAGAAAAGCC[A/G]GGTGGGTTTTGCCGGGACTGTTGGG
Phenotype: MIM: 191760 MIM: 613580
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC647115 PubMed Links

Gene Details

Gene: LOC647115
Gene Name: translation initiation factor IF-2

There are no transcripts associated with this gene.

Gene: UGP2
Gene Name: UDP-glucose pyrophosphorylase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001521.1	148	Intron			NP_001001521.1
NM_006759.3	148	Intron			NP_006750.3
XM_005264537.2	148	UTR 5			XP_005264594.1
XM_005264538.1	148	UTR 5			XP_005264595.1
XM_006712088.1	148	Intron			XP_006712151.1
XM_011533091.1	148	Intron			XP_011531393.1
XM_017004855.1	148	Intron			XP_016860344.1
XM_017004856.1	148	UTR 5			XP_016860345.1
XM_017004857.1	148	Intron			XP_016860346.1

Gene: WDPCP
Gene Name: WD repeat containing planar cell polarity effector

There are no transcripts associated with this gene.

View Full Product Details