Product Details
- SNP ID
-
rs658127
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
44
- Location
-
Chr.1:57000749 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- TGTTTCCTGGATAGATGTTCTCAGC[C/T]CATTCTTCTTTTTGGATGCCCCAAG
- Phenotype
-
MIM: 603448
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
DAB1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs75616607] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- DAB1
- Gene Name
- DAB1, reelin adaptor protein
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_021080.3 |
|
Intron |
|
|
NP_066566.3 |
- Gene
- LOC105378749
- Gene Name
- uncharacterized LOC105378749
There are no transcripts associated with this gene.
View Full Product Details